På dna-dagen

Idag är det tydligen dna-dagen enligt någon; det är i alla fall roligare än kanelbullens dag. Den 25 april 1953 var dagen då artiklarna (Watson & Crick 1953; Franklin & Gosling 1953; Wilkins, Stokes & Wilson 1953) om dna-molekylens struktur publicerades, och dagen då en typ 150-årig jakt på arvsanlagens molekylära natur på något sätt kulminerade. Från äckligt var från något sår till dna-sekvenser, typ. Alla har sett någon bild på dna-strängen, så jag väljer medvetet att inte visa någon sådan. Istället tänkte jag skriva några rader om dna som kod, en vanlig metafor som både är bra och dålig.

Deoxyribonukleinsyra (dna) är en uppbyggt av en ryggrad av deoxyribos samt olika kombinationer av fyra kvävebaser (adenosin, tymin, guanidin och cytosin; de förkortas med sin begynnelsebokstav som A, T, G och C). De kan kombineras i olika ordning och det är följden av A, T, G och C som bildar den dna-sekvens som lagrar biologisk information. En normal dna-molekyl består av två strängar som löper i motsatt riktning. Baserna bildar par där G kombineras med C och A med T. Båda strängarna lagrar alltså samma information men i motsatt och, som det kallas, komplementär riktning.

Sedan bildar dna-molekyler kromosomer: en kromosom är en lång dna-molekyl upplindad på proteiner. Vi diploida organismer har två uppsättningar av våra kromosomer: en från mamma och en från pappa. Genomet är den sammanlagda sekvensen från en uppsättning av alla kromosomer. När en pratar om det mänskliga genomet menar en den mänskliga referenssekvensen, som är ett exempel på hur en uppsättning kromosomer kan se ut. Det finns naturligtvis genetisk variation mellan indiver. Ta till exempel följande bit från människans kromosom 1:

>1 dna:chromosome chromosome:GRCh37:1:11013:12345:1
GGGGGTTGGGGGGGCGTGTGTTGCAGGAGCAAAGTCGCACGGCGCCGGGCTGGGGCGGGG
GGAGGGTGGCGCCGTGCACGCGCAGAAACTCACGTCACGGTGGCGCGGCGCAGAGACGGG
TAGAACCTCAGTAATCCGAAAAGCCGGGATCGACCGCCCCTTGCTTGCAGCCGGGCACTA
CAGGACCCGCTTGCTCACGGTGCTGTGCCAGGGCGCCCCCTGCTGGCGACTAGGGCAACT
GCAGGGCTCTCTTGCTTAGAGTGGTGGCCAGCGCCCCCTGCTGGCGCCGGGGCACTGCAG
GGCCCTCTTGCTTACTGTATAGTGGTGGCACGCCGCCTGCTGGCAGCTAGGGACATTGCA
GGGTCCTCTTGCTCAAGGTGTAGTGGCAGCACGCCCACCTGCTGGCAGCTGGGGACACTG
CCGGGCCCTCTTGCTCCAACAGTACTGGCGGATTATAGGGAAACACCCGGAGCATATGCT
GTTTGGTCTCAGTAGACTCCTAAATATGGGATTCCTGGGTTTAAAAGTAAAAAATAAATA
TGTTTAATTTGTGAACTGATTACCATCAGAATTGTACTGTTCTGTATCCCACCAGCAATG
TCTAGGAATGCCTGTTTCTCCACAAAGTGTTTACTTTTGGATTTTTGCCAGTCTAACAGG
TGAAGCCCTGGAGATTCTTATTAGTGATTTGGGCTGGGGCCTGGCCATGTGTATTTTTTT
AAATTTCCACTGATGATTTTGCTGCATGGCCGGTGTTGAGAATGACTGCGCAAATTTGCC
GGATTTCCTTTGCTGTTCCTGCATGTAGTTTAAACGAGATTGCCAGCACCGGGTATCATT
CACCATTTTTCTTTTCGTTAACTTGCCGTCAGCCTTTTCTTTGACCTCTTCTTTCTGTTC
ATGTGTATTTGCTGTCTCTTAGCCCAGACTTCCCGTGTCCTTTCCACCGGGCCTTTGAGA
GGTCACAGGGTCTTGATGCTGTGGTCTTCATCTGCAGGTGTCTGACTTCCAGCAACTGCT
GGCCTGTGCCAGGGTGCAAGCTGAGCACTGGAGTGGAGTTTTCCTGTGGAGAGGAGCCAT
GCCTAGAGTGGGATGGGCCATTGTTCATCTTCTGGCCCCTGTTGTCTGCATGTAACTTAA
TACCACAACCAGGCATAGGGGAAAGATTGGAGGAAAGATGAGTGAGAGCATCAACTTCTC
TCACAACCTAGGCCAGTAAGTAGTGCTTGTGCTCATCTCCTTGGCTGTGATACGTGGCCG
GCCCTCGCTCCAGCAGCTGGACCCCTACCTGCCGTCTGCTGCCATCGGAGCCCAAAGCCG
GGCTGTGACTGCT

Men om jag intresserade mig för den här sekvensen skulle jag antagligen betrakta den på en ännu högre abstraktionsnivå, ungefär såhär. Detta är en bild från genomläsaren Ensembl. Detaljerna är inte så viktiga; poängen med den här illustrationen är att genetiken till stor del abstraherar bort den underliggande biokemin. Vi betraktar inte dna-sekvensen direkt, utan med olika bekvämare representationer av dna-sekvensen.

ensembl_human_chr1

Ibland pratar en om den genetiska koden. Med det uttrycket avses inte hela genomet, utan de ungefär 2% som specificerar sekvensen för proteiner. Det är nämligen så att vissa dna-sekvenser, proteinkodande gener, följer en viss kod som motsvarar en sekvens av aminosyror. Aminosyror, i sin tur, bygger upp proteiner, som är biologiskt aktiva stora organiska molekyler som gör saker i celler och kroppar. Proteiner kan vara enzymer som katalyserar olika reaktioner, transportproteiner som flyttar molekyler fram och tillbaka, strukturella proteiner som bygger upp vävnader etc etc. Den genetiska koden, som det kallas, betsår av tripletter av baser, där en tre baser motsvarar en aminosyra. ATG till exempel, motsvara aminosyran metionin samt även startsignalen för att bygga ett protein. TTT motsvarar fenylalanin, GTA valin och så vidare. TAA, TAG eller TGA innebär att den kodande genen är slut och att proteinsekvensen är färdig.

Men det finns andra dna-sekvenser som har andra funktioner än att koda för proteiner. De är svårare att beskriva och hantera, för deras kod är inte lika regelbunden och lätthanterlig som den genetiska koden, men de är ändå viktiga. Till exempel finns det dna-sekvenser som reglerar när och hur mycket olika delar av kroppen kommer använda proteinkodande gener till att faktiskt tillverka proteiner.

Majoriteten av genomet består inte av gener, utan av diverse jox som inte fyller någon direkt funktion. Spaghettikod är ett skällsord som programmerare ibland använder för kod som är svår att överblicka, förvirrande, och som när den körs kommer hoppa hit och dit. Om det mänskliga genomet ska beskrivas som kod är det förmodligen någon sorts spaghettikod. Jag tänkte länge att ett datorprogram är en fruktansvärt dålig metafor för ett genom, eftersom programkod är konstruerad av mänskliga medvetanden som har en plan. Men mina vänner som arbetar med programmering har övertygat mig om att ett tillräckligt stort mjukvaruprojekt med många inblandade ibland utvecklas lite som ett genom, med en kombination av slumpvisa händelser och naturligt urval, inte bara som en process av rationell design.

#blogg100, språkförbistring och etologens topplista

Jag måste säga att jag är ganska nöjd med att det gått över 50 poster i #blogg100 innan jag skriver en post om #blogg100. Överhuvudtaget tycker jag att det fallit ganska väl ut så långt. Har lyckats avsluta och publicera ett gäng poster som legat och väntat ett bra tag. ”Åtminstone tre sorters osäkerhet”, till exempel, är ungefär ett halvår gammal. Jag hade väntat mig att komma på mig själv med många sluga knep för att dela upp poster på flera dagar, men jag har inte gjort så många dumheter, mer än posta korta länktips, rekommendationer och citat. Jag har i alla fall ingen intention att fortsätta om jag inte har något vettigt att säga, så det är mycket möjligt att jag lägger av innan etthundrastrecket och återgår till vanlig takt.

Min blogg lider av en viss språkförbistring (vilket jag skrivit om på engelska här). En del saker vill jag skriva på engelska så att eventuella icke-svensktalande läsare kan förstå. Samtidigt vill jag inte driva två bloggar. Någon måtta får det vara. Jag har ingen aning om ifall språkblandningen jag håller på med nu är en bra idé eller inte, men det får vara så tills vidare

Hur som helst är det inte bara jag som ägnar mig åt #blogg100-galenskaper. En annan deltagare med biologianknytning är Johan Lind, docent i etologi, som gör en topp 100-lista över djur med egna fotografier. Mycket fint och allmänbildande! Om jag gjorde en topplista skulle den bli betydligt kortare, men hönan skulle i alla fall komma på plats ett. Titta till exempel på nummer 98, mindre havsnål och nummer 83, Chromodoris reticulata!

Dagens rekommendation: The Dog Zombie

Naturligtvis är jag, som är en doktorand som bloggar, svag för att läsa doktorander som bloggar. Jessica Perry Hekman är en sådan och jobbar dessutom också med domesticering och beteendegenetik. Hur mycket bättre kan det bli?

Läs till exempel den här posten om Belyaevs rävar (något jag själv borde skriva om också) eller den här om Dias & Resslers studie om epigenetiskt arv och lukt (min post här).

Om varför alla inte har helskägg

Häromdagen kom en artikel om ”Negative frequency-dependent preferences and variation in male facial hair”. Eller, som TT:s skribent uttryckte det: ”Helskägg snart helt ute”. Nåja. Nu har jag kommit över min initiala bitterhet över att den här artikeln redan fått mer uppmärksamhet än min forskning någonsin kommer att få, och den kan faktiskt vara en helt okej liknelse för att beskriva frekvensberoende naturligt urval. Den handlar alltså inte om naturligt urval eller om hur evolutionen skulle format våra preferenser för eller emot skägg. Den handlar om hur skäggmode litegrann liknar evolutionära mönster som finns i naturen.

Frekvensberoende naturligt urval är en av de evolutionära processer som kan bevara genetisk variation i en population. Det finns andra, som i exemplet Soay-fårens horn, men allihop är fenomen som på något sätt förklarar varför naturligt urval inte sorterar bort all variation tills bara den bäst anpassade genetiska varianten finns kvar. Det är annars vad som borde hända i längden. Tänk dig att det finns två varianter av en gen, kalla dem A och a. Frekvensberoende urval är om urvalstrycket, alltså hur bra för fortplantningsförmågan A är i förhållande till a, beror på hur många A och a det finns i populationens genpool. Kanske ger A en stor fördel när det är ett relativt unikt anlag som få bär på, men sämre när nästan hela populationen bär på A. Det kan uppstå situationer där både A och a stabilt finns i populationen, men deras frekvenser skiftar fram och tillbaka.

För att det där ska verka mindre abstrakt: tänk dig skägg! Janif, Brooks & Dixson (2014) visade män och kvinnor bilder på män med mer eller mindre skägg och lät dem bedöma hur attraktiva de var. De visade grupper av bilder med olika sammansättning  av bilder med mycket eller lite skägg (en grupp med få renrakade, en med lika och en med få helskägg). De kom fram till att bedömningarna berodde på gruppens sammansättning. Skägg såg mer attraktivt ut om få av bilderna i gruppen hade skägg. Slätrakat såg mer attraktivt ut om få av bilderna var rakade. När det gällde stubb var det ingen större skillnad. Män och kvinnor bedömde attraktivitet typ likadant. Om en viss ansiktsfrisyr är ovanlig så förefaller den vara mer tilltalande än om den är vanlig.

Det finns exempel på liknande fenomen i naturen. Guppyhanar kommer med olika sorters ärftliga färgglada teckningar som inte verkar sorteras bort av naturligt urval. Hughes & co (2013) satte samman grupper där hanarna hade olika kombinationer av mönster och kom fram till att de sällsynta hanarna var de som fick flesta avkomma. Guppyhonor utövar frekvensberoende urval av ovanliga färgmarkeringar. Människor har alltså liknande preferenser för skägglängd, men där slutar också likheterna. Janif, Brooks & Dixson har inte hittat frekvensberoende naturligt urval för skägg. Låt oss gå igenom varför inte, i plågsam detalj:

1) En bedömning på skala -4 till 4 hur attraktivt ett ansikte är fungerar antagligen ganska dåligt som indikator på reproduktiv framgång. Naturligt urval verkar inte på snygghet, utan mängden avkomma. Det finns säkert något samband, men frågan är hur stor (obefintlig) roll skägg egentligen spelar när människor väljer partner.

2) Tidsperspektivet för skäggmode är betydligt kortare än människans generationstid. Eller: hur mycket skägg en människa väljer att ha är en väldigt plastisk egenskap. Den ändrar sig under livets gång och som svar på en mängd andra saker. Det finns garanterat någon sorts genetisk komponent (hårväxt verkar gå i släkten), men om skägg blivit inne på sista tiden är det inte huvudsakligen på grund av ärftlighet. Däremot är det möjligt att författarna hittat ett kulturell mönster som till sin dynamik liknar frekvensberoende naturligt urval. Kanske anpassar män sitt ansiktshår till frekvensen av olika frisyrer omkring dem för att de vill känna sig attraktivare.

3) Även om partnervalet skulle delvis hänga på skägget och skägget vara ärftligt, så finns det två andra viktiga frågor. Vilka andra egenskaper är kopplade till att ha skägg eller inte? Och vilka andra egenskaper vill kvinnor se hos en partner, förutom den typ av ansiktshår hon föredrar? Antagligen ganska många andra saker som antagligen är väldigt mycket viktigare. Därför är det inte säkert att preferenser för skägg eller inte skägg har någon effekt på partnerval och reproduktion överhuvudtaget! Detta fenomen kallas evolution i flera dimensioner och korrelationerna mellan egenskaper beskrivs av G-matrisen. Poängen är att om en bara tittar på en enda egenskap och urval i förhållande till den egenskapen kan en råka göra helt galna förutsägelser som inte har något med verkligheten att göra, ifall det skulle råka falla sig så att den egenskapen är korrelerad med andra egenskaper som också står under naturligt urval.

Förresten,

Återstår bara att gratulera alla slätrakade män. Ni är hetast! Just nu i alla fall.

Nja. Nu var det faktiskt så att slätrakat bedömdes minst attraktivt under alla tre förhållanden. Jo, var fler som föredrog slätrakat i gruppen med få rakade bilder än i gruppen med många slätrakade. Men det var ändå mindre populärt än någon skäggig variant.

(Potentiell intressekonflikt: undertecknad bär helskägg och tror inte att mänsklig kultur bör beskrivas med evolutionsliknelser.)

Litteratur

Janif, Z. J., Brooks, R. C., Dixson, B. J. (2014) Negative frequency-dependent preferences and variation in male facial hair. Biology letters. 10(4) 10.1098/rsbl.2013.0958

Hughes, K. A., Houde, A. E., Price, A. C., & Rodd, F. H. (2013). Mating advantage for rare males in wild guppy populations. Nature, 503(7474), 108-110.

Naturligt urval: Ett par svårigheter med evolutionspsykologi

Evolutionspsykologi är en gren av psykologi som försöker använda sig av evolution för att förstå mänskligt beteende. Fast om det beskrivs så brett är evolutionspsykologin av idag knappast den enda evolutionära psykologin. Freuds psykoanalys lutade sig på en, om än märklig, tolkning av dåtidens evolutionsbiologi. Till och med Skinners radikala behaviorism har en syn på människan som biologisk varelse bland andra djur; det är bara en väldigt tunn mänsklig natur som till största del består av mekanismer för inlärning. Till den som inte tror mig om det senare rekommenderar jag den lilla boken av Naour (2009) som handlar om ett möte mellan E. O. Wilson, som myntade sociobiologin, och B. F. Skinner, en synnerligen otippad diskussion som inträffade 1987. Inte nog med att Skinner lägger ut texten om hur han ser sin psykologi som sammankopplad med evolutionsbiologi. E O Wilson beskriver sig dessutom som behaviorist. Det är en mycket rolig bok. All psykologi med självaktning måste ha någon inställning till människans evolution, och evolutionspsykologer är inte de enda som tänker på ämnet.

Samtida evolutionspsykologi intresserar sig för de beteenden som är någotsånär universella för människor. I den mån de också är någotsånär jämförbara med beteenden som finns i andra djur finns det en chans att använda jämförande metoder. Det går att spåra dem i släktträd (fylogenetiska träd) och se vilka ekologiska omständigheter som orsakar vissa anpassningar. Problemet är bara att människor är så konstiga. Vi pratar språk och överför kulturell information i betydligt mer än de flesta andra djur. Om det inte finns någon bra jämförelsepunkt fungerar fylogenetiska metoder dåligt. Så de egenskaper som kanske är allra intressantast lämpar sig inget vidare för evolutionär analys.

Dessutom är evolutionspsykologer mest intresserade av mänskliga egenskaper som är anpassningar. Alltså, de egenskaper som gynnats av naturligt urval därför att de fick våra förfäder och -mödrar att producera mer avkomma. En skulle kunna tänka sig att jämföra människor med olika egenskaper, se efter hur många barn de får och på så sätt dra slutsatser om ifall beteendet har haft adaptivt värde eller ej. Problemet är att naturligt urval verkar genom att sortera bort variation. Om det finns naturligt urval för en egenskap som är tillräckligt starkt och vara tillräckligt lång tid sorteras den genetiska variationen bort. Förr eller senare blir det bara den mest framgångsrika genvarianten kvar. Så samtida genetisk variation i ett beteende är ingen vidare guide till hur det såg ut i historien. Buss (2005) skriver om detta i sitt introduktionskapitel till en handbok om evolutionspyskologi. Han är föredömligt tydlig med hur evolutionspsykologer utgår ifrån att naturligt urval är en optimerande process som går att jämföra med design, men verkar fullständigt omedveten om problemen med det. Det skulle teoretiskt sett gå att, med populationsgenetiska metoder, spåra gener som varit föremål för naturligt urval under mänsklig evolution, men vi vet helt enkelt för lite om vad gener gör för att kunna tolka dem. Så tyvärr, beteendegenetik är till väldigt liten hjälp. Kom tillbaka om hundra år.

Så vilka metoder har evolutionpsykologer till sitt förfogande för att studera evolutionära anpassningar som gör oss mänskliga? Ja, ironiskt nog är evolution och genetik inte till någon större hjälp, men de har alltid fysiologiska, neurologiska och psykologiska experiment.

Litteratur

Naour, P (2009) E. O. Wilson and B. F. Skinner. A dialogue between sociobiology and radical behaviorism. New York: Springer.

Buss, DM (2005) Conceptual foundations of evolutionary psychology. I: Buss DM (red) Handbook of evolutionary psychology. New Jersey: John Wiley & Sons Inc.

Ett litet försvar av den själviska genen

IMG_20140414_131543

Den själviska genen är en bok av Richard Dawkins som kom ut 1976. Den handlar om djurs beteende och framför allt om hur det kommer sig att djur så ofta samarbetar, hjälps åt och beter sig hyggligt mot varandra trots att deras beteende formats av evolution genom naturligt urval. Boken är både bättre och sämre än sitt rykte.

Bättre, för väldigt mycket kritik om hur den själviska genen rättfärdigar själviskt beteende är fånig. Syftet med texten är precis tvärtom att popularisera evolutionära modeller som förklarar osjälviskt beteende! Det ligger något i att adjektivet ”självisk” lätt leder tanken fel. Genetiska varianter tycker och tänker naturligtvis ingenting, och de är inte själviska heller. De bara är. Men Dawkins’ allegorier om organismer som överlevnadsmaskiner konstruerade av själviska replikatorer är en betydligt bättre bild av evolution än många andra. Den fångar åtminstone hur riktningslös processen är. Evolutionen bryr sig inte om oss, vår moral eller våra ideal om vad som är skönhet eller god design. ”Genialiska”, ”samarbetsvilliga” eller ”solidariska” gener fångar inte den delen av evolution särskilt väl. Om genen ska ha något adjektiv så är det ”självisk”. Kanske också ”nyckfull”.

Sämre, för Den själviska genen är inte den allomfattande boken om evolution, gener och beteende. Faktum är att den behandlar ett ganska begränsat område. Det är inget fel i det, men någon som får hela sin kunskap om evolution från Den själviska genen och från Dawkins’ evolutionsspekulationer i The God Delusion får en ganska bristfällig bild av evolutionsbiologi. Inte nödvändigtvis felaktig, men inte komplett. Personligen tycker jag också att den gjorde världen en stor otjänst genom att mynta ordet ”mem”. Men det är nog ett gräl vi borde ta en annan dag. Att en populär/vetenskaplig bok behandlar ett avgränsat ämne (mest djurs sociala beteende) med några verktyg (mycket Hamiltons regel och evolutionärt stabila strategier) är bra och rimligt. Bara en inte glömmer att evolution är större än det ämnet och de verktygen.

Hur som helst tror jag att många av missförstånden kring Den själviska genen, föga förvånande, har att göra med förståelsen av ordet ”gen”. ”Den själviska genen” avser naturligtvis inte gener i betydelsen ”den själviska dna-sekvensen med någon funktion” utan ”den själviska genetiska varianten”. Boken använder alltså ordet gen i den klassiska betydelsen, inte den molekylära. Som Dawkins skriver:

In the title of this book the word gene means not a single cistron [kodande dna-sekvens, alltså molekylär gen] but something more subtle. /…/ A gene is defined as any portion of chromosomal material that potentially lasts for enough generations to serve as a unit of natural selection. (s. 28)

Det betyder för det första att kritik som går ut på att den själviska genen är utdaterad för att den handlar om gener istället för genuttryck, reglerande varianter, epigenetik osv helt missar målet. Det spelar ingen som helst roll för teorin som beskrivs i Den själviska genen ifall variationen beror på ändringar i proteinsekvens, ändringar i reglerande sekvenser eller för den delen epigenetisk arv. De resultat Dawkins’ bygger på analyserar populationen och evolutionen på en annan nivå som är nästan helt agnostisk till den molekylära grunden för ärftligheten. Och det gäller mycket teoretisk evolutionsbiologi, populationsgenetik och kvantitativ genetik. Bara variationen är ärftlig och beter sig som genetisk variation så fungerar teorin lika bra.

Vidare betyder det att själviskheten som en genetisk variant utövar huvudsakligen går ut över andra varianter av samma gen. Det är inte de genetiska varianternas krig mot varandra, utan konkurrens mellan varianter på samma plats i genomet. I övrigt så formas genetiska varianter av varandra och bildar familjer, komplex och interaktioner som evolverar tillsammans. Det är klart, en genetisk variant kan påverkar de som ligger nära på samma kromosom och de andra varianter den interagerar med (de tekniska termerna för detta är koppling och epistasi, om någon undrar). Men överlag finns det ingen konflikt mellan liknelser där enskilda varianter kallas själviska och liknelser där gener sitter i någon sorts kommitté eller förhandlingar. De är bara olika perspektiv på samma process.

Litteratur

Dawkins, R. (2006) The selfish gene. Oxford University Press. (Det är en jubileumsutgåva. Boken gavs först ut 1976.)