Etikettarkiv: gene editing

Forskare vill prata om den nya gentekniken, men vem vill prata med forskare?

Publicerat i molekylärgenetik, science communication, svenska av

Forskare: ”Vi måste prata!”

Tystnad. Gryllidae-läten hörs i bakgrunden.

Andra forskare: ”Äh, håll tyst!”

För några veckor sedan kom det en debattartikel i SvD: ”Vi måste ta ställning till (eller samtala om, beroende på var på sidan man läser) den nya gentekniken” från ett gång forskare kopplade till gruppen CRISPRideas vid Pufendorfinstitutet vid Lunds universitet. Deras uppgift verkar vara att analysera hur genredigeringstekniker som CRISPR/Cas debatteras:

Genom jämförande analyser av debatten i framförallt de nordiska länderna, men även globalt, kommer vi att undersöka hur vetenskaplig kunskap, värderingar och normer har påverkat såväl experter som allmänheten och olika intressenter i deras uppfattning om de nya genredigeringsteknikernas möjligheter och risker.

Det förefaller som att debattartikeln skrevs i samband med deras möte ”Medical and agricultural perspectives on new genome editing technologies” i november, och det ser ut att ha varit ett kul möte.

Synd att debattartikeln blev tråkig. Men det är kanske inte så konstigt. Om man är en grupp forskare med olika bakgrund ens mandat är att undersöka om en debatt, så är kanske den mest naturliga åsikten att driva att en bred debatt är bra och nödvändig.

Det kan låta som en åsikt som det är svårt att invända mot, men komiskt nog finns det andra som gör det. För strax därpå tyckte Jesper Sundström och Torbjörn Fagerström att det var ”Risk för ohederlig debatt om gensaxen”.

Några kommentarer om debattartikeln. Jag förstår att de hade begränsat utrymme, men här på min blogg kan jag breda ut mig hur mycket jag vill, så vi kan titta närmare på några påståenden.

Get some of that prime jive, get some of that, get get get down

Artikeln börjar med prime-redigering, en ny variant av CRISPR/Cas-redigering som publicerades nyligen (Anzalone & al 2019). Det är tydligen på grund av den som det är extra viktigt att debattera. (Oklart vad det borde heta på svenska: ”prime” är ”början” eller ”start”, som i ”primer”, en kort RNA eller DNA-bit som hjälper en enzymatisk dna-kopiering starta.)

Idén med prime-redigering är att istället för att klippa av hela dna-strängen och klistra ihop den med en ny, så tar man bara av halva i taget, för att inte råka ha sönder för mycket, och syntetiserar det nya dna:t på plats, så att det säkert kommer i kontakt med den nyklippta dna-strängen. Det är en påhittig konstruktion som kombinerar CRISPR-systemet, stulet från bakterier, med omvänt transkriptas, stulet från virus.

Varför behövs all den här påhittigheten? För att genredigering i själva verket fungerar ganska dåligt. Att slå ut en gen i cellkultur är en relativt smal sak: klipp ett hål och låt cellen klistra ihop den bäst den kan, förmodligen blir resultatet en trasig gen. Men att byta ut en variant av en gen med en annan är svårare; majoriteten av försöken misslyckas. Det är okej i labbet, när det bara är att odla nya celler och försöka igen. Det skulle vara mindre okej i en genterapisituation där en patient ska få en ny fungerande genvariant. Prime-redigering kanske är lösningen.

Det är inte lätt att veta om prime-redigering kommer bli det nya, eller om det bara är en i serien av olika förfinade CRISPR/Cas-varianter. Som utgångspunkt för debatt ställer den inga nya frågor som inte redan ställs av tidigare CRISPR/Cas-varianter, precis som CRISPR/Cas inte leder till några nya frågor som inte redan ställdes av rekombinant DNA och fosterdiagnostik. Däremot kanske den gör att genredigering blir lättare att få att fungera, och på så sätt kan de frågorna bli mer aktuella.

Har prime-redigering botat 175 genetiska sjukdomar? Nej, ännu inte en enda.

I debattartikeln beskriver de vad prime-redigering kan göra så här. Det är föredömligt korrekt, men det är ändå värt att understryka vad det betyder:

David Liu och hans forskargrupp visar att den nya gensaxen fungerar anmärkningsvärt väl: de lyckades korrigera ett häpnadsväckande antal mutationer (175 stycken!) i olika celler från möss och människor. Bland annat har man lyckats korrigera de tidigare svåråtkomliga sjukdomsmutationerna som orsakar sickelcell-anemi och den allvarliga nervsjukdomen Tay Sachs sjukdom. Möjligheterna med tekniken är stora. Liu och hans forskargrupp hävdar att över 80 procent av alla nu kända sjukdomsalstrande mutationer kan korrigeras med prime-redigering. (min kursivering)

Det prime-redigering löser är att den gör det lättare att faktiskt redigera, inte bara ta sönder. Det har varit svårt för CRISPR/Cas i praktiken att ersätta en genvariant med en annan. Men för att göra någon form av genterapi med prime-redigering måste någon också se till att det går att rikta redigeringarna till det organ eller den vävnad där problemet finns, och visa att det är tillräckligt att den fungerande genvarianten uttrycks där för att sjukdomsförloppet ska vändas, eller åtminstone avstanna.

Är de dna-redigerade kinesiska barnen skyddade mot hiv?

Sedan pratar de om det kinesiska fallet med barn som (under falska förespeglingar) fått sitt dna-redigerat i en gen som har med hiv-infektion att göra. Den här formuleringen, däremot, är så slarvig att den inte riktig är sann:

I fjol använde en kinesisk forskare Crispr för att förändra arvsmassan hos foster så att de skyddas mot hiv. Detta ledde till en storm i forskarvärlden eftersom permanent förändring av arvsmassan, som förs vidare till kommande generationer, är förbjudet i Sverige och många andra länder.

Det finns inget snällare sätt att beskriva kunskapsläget än att den kinesiska forskaren (He Jiankui) hoppades att barnen skulle bli resistenta mot hiv. Det är inte alls säkert att de faktiskt är resistenta. Vad han gjorde var att klippa hål i genen CCR5 som kodar för en av de receptorer som hiv kan använda för att komma in i cellen. Mutationerna var inspirerade av en allel som kallas CCR5-delta32 och som ger resistens mot vissa typer av hiv genom att slå ut receptorn. Förmodligen har mutationerna som barnen bär på också den effekten att de slår ut receptorn, och i så fall är de förmodligen resistenta mot vissa typer av hiv. Dessutom är det mycket möjligt att barnen har olika mutationer i olika delar av kroppen, så de kanske har en fungerande CCR5 i vissa kroppsdelar och en trasig i andra.

Jag tycker det är fel att koncentrera sig på att det var en permanent förändring i arvsmassan, som om det var det enda problemet. Att barnen, när de växer upp, kommer behöva oroa sig för om eventuella problem går i arv är illa, men det är bara ett i en rad av risker de utsätts för. Det är frågan om en oprövad behandling, med helt okända biverkningar, dåligt genomförd (fråga vem som helst som jobbat med CRISPR/Cas själv vad de tycker om Jiankuis kvalitetskontroll av redigeringar), utförd på ofödda barn vars föräldrar nästan säkert fått bristfällig information … Att lägga fram det som om det var frågan om en behandling som faktiskt gjorde nytta, men som tyvärr är ärftlig är att missa poängen.

Finns det någon risk att Sverige hamnar på efterkälken pga av etiska kval?

Författarna oroar sig, efter det kinesiska fallet, att genredigering ska förbjudas och Sverige på något sätt hamna på efterkälken. Det hade varit hjälpsamt om de givit något exempel på vem i Sverige som tycker detta?

Eftersom det finns en stark opinion mot GMO och det är svårt att få tillstånd för odling av GMO-baserade grödor i Europa har den nya regleringen kraftigt bromsat forskningen inom området. Det hindrar utvecklingen av hållbara grödor. Skulle samma sak drabba Crispr-tekniker för medicinsk tillämpning kommer den vetenskapliga utvecklingen att stanna av och våra möjligheter att bota allvarliga genetiska sjukdomar kommer att reduceras.

Genetiska förändringar i människor som går i arv är inte tillåtet i Sverige, oavsett teknik (Lag (2006:351) om genetisk integritet m.m.). Som synes är lagen från 2006, så inget nytt under solen.

Debatt om debatten om debatten

Till sist, det här är kanske långsökt, men debatten om debatten fick mig att tänka på detta fina referat av svensk lärd debatt från Tage Danielssons Grallimatik (1966).

Professor Gunnar Biörck:
Jag gör mig härmed till tolk för en tigande opinion som ogillar normlöshet och trolöshet och den junta av kulturradikaler som skriver om sånt.

Fil. dr Olof Lagercrantz:
Det är farligt med okunniga professorer.

Fil. lic. Johan Asplund:
Naturvetenskaparna borde någon gång säga något.

Naturvetenskaparna borde någon gång säga något. Det tycker undertecknarna också:

I vårt tvärvetenskapliga projekt vid Pufendorfinstitutet på Lunds universitet – CRISPRideas – bryts naturvetenskapliga och medicinska synsätt mot etiska, filosofiska, juridiska och humanistiska synsätt. Det har vidgat våra vyer och stärkt oss i vår uppfattning att det vetenskapliga samfundet kan och skall vara en partner i svåra men viktiga samtal. Björnen har lämnat sitt ide – den är inte farlig, bara man är varlig! (Slutklämmen på slutrepliken, ”Att inte debattera är inte ett alternativ”.)

Litteratur

Antonio Regalado. (2019) China’s CRISPR: babies. MIT Technology Review.

Andrew V Anzalone et al. (2019) Search-and-replace genome editing without double-strand breaks or donor DNA. Nature.

Journal club: ”Template plasmid integration in germline genome-edited cattle”

Publicerat i bioteknik, english, genetik, molekylärgenetik av

(This time it’s not just a Journal Club of One, because this post is based on a presentation given at the Hickey group journal club.)

The backstory goes like this: Polled cattle lack horns, and it would be safer and more convenient if more cattle were born polled. Unfortunately, not all breeds have a lot of polled cattle, and that means that breeding hornless cattle is difficult. Gene editing could help (see Bastiaansen et al. (2018) for a model).

In 2013, Tan et al. reported taking cells from horned cattle and editing them to carry the polled allele. In 2016, Carlson et al. cloned bulls based on a couple of these cell lines. The plan was to use the bulls, now grown, to breed polled cattle in Brazil (Molteni 2019). But a few weeks ago, FDA scientists (Norris et al 2019) posted a preprint that found inadvertent plasmid insertion in the bulls, using the public sequence data from 2016. Recombinetics, the company making the edited bulls, conceded that they’d missed the insertion.

”We weren’t looking for plasmid integrations,” says Tad Sonstegard, CEO of Recombinetics’ agriculture subsidiary, Acceligen, which was running the research with a Brazilian consulting partner. ”We should have.”

Oops.

For context: To gene edit a cell, one needs to bring both the editing machinery (proteins in the case of TALENS, the method used here; proteins and RNA in the case of CRISPR) and the template DNA into the cell. The template DNA is the DNA you want to put in instead of the piece that you’re changing. There are different ways to get the components into the cell. In this case, the template was delivered as part of a plasmid, which is a bacterially-derived circular DNA.

The idea is that the editing machinery should find a specific place in the genome (where the variant that causes polledness is located), make a cut in the DNA, and the cell, in its efforts to repair the cut, will incorporate the template. Crucially, it’s supposed to incorporate only the template, and not the rest of the plasmid. But in this case, the plasmid DNA snuck in too, and became part of the edited chromosome. Biological accidents happen.

How did they miss that, and how did the FDA team detect it? Both the 2016 and 2019 paper are short letters where a lot of the action is relegated to the supplementary materials. Here are pertinent excerpts from Carlson & al 2016:

A first PCR assay was performed using (btHP-F1: 5’- GAAGGCGGCACTATCTTGATGGAA; btHP-R2- 5’- GGCAGAGATGTTGGTCTTGGGTGT) … The PCR creates a 591 bp product for Pc compared to the 389 bp product from the horned allele.

Secondly, clones were analyzed by PCR using the flanking F1 and R1 primers (HP1748-F1- 5’- GGGCAAGTTGCTCAGCTGTTTTTG; HP1594_1748-R1- 5’-TCCGCATGGTTTAGCAGGATTCA) … The PCR creates a 1,748 bp product for Pc compared to the 1,546 bp product from the horned allele.

All PCR products were TOPO cloned and sequenced.

Thus, they checked that the animals were homozygotes for the polled allele (called ”Pc”) by amplifying two diagnostic regions and sequenced them to check the edit. This shows that the target DNA is there.

Then, they used whole-genome short read sequencing to check for off-target edits:

Samples were sequenced to an average 20X coverage on the Illumina HiSeq 2500 high output mode with paired end 125 bp reads were compared to the bovine reference sequence (UMD3.1).

Structural variations were called using CLC probabilistic variant detection tools, and those with >7 reads were further considered even though this coverage provides only a 27.5% probability of accurately detecting heterozygosity.

Upon indel calls for the original non-edited cell lines and 2 of the edited animals, we screened for de novo indels in edited animal RCI-001, which are not in the progenitor cell-line, 2120.

We then applied PROGNOS4 with reference bovine genome build UMD3.1 to compute all potential off-targets likely caused by the TALENs pair.

For all matching sequences computed, we extract their corresponding information for comparison with de novo indels of RCI-001 and RCI-002. BEDTools was adopted to find de novo indels within 20 bp distance of predicted potential targets for the edited animal.

Only our intended edit mapped to within 10 bp of any of the identified degenerate targets, revealing that our animals are free of off-target events and further supporting the high specificity of TALENs, particularly for this locus.

That means, they sequenced the animals’ genomes in short fragment, puzzled it together by aligning it to the cow reference genome, and looked for insertions and deletions in regions that look similar enough that they might also be targeted by their TALENs and cut. And because they didn’t find any insertions or deletions close to these potential off-target sites, they concluded that the edits were fine.

The problem is that short read sequencing is notoriously bad at detecting larger insertions and deletions, especially of sequences that are not in the reference genome. In this case, the plasmid is not normally part of a cattle genome, and thus not in the reference genome. That means that short reads deriving from the inserted plasmid sequence would probably not be aligned anywhere, but thrown away in the alignment process. The irony is that with short reads, the bigger something is, the harder it is to detect. If you want to see a plasmid insertion, you have to make special efforts to look for it.

Tan et al. (2013) were aware of the risk of plasmid insertion, though, at least when concerned with the plasmid delivering the TALEN. Here is a quote:

In addition, after finding that one pair of TALENs delivered as mRNA had similar activity as plasmid DNA (SI Appendix, Fig. S2), we chose to deliver TALENs as mRNA to eliminate the possible genomic integration of TALEN expression plasmids. (my emphasis)

As a sidenote, the variant calling method used to look for off-target effects (CLC Probabilistic variant detection) doesn’t even seem that well suited to the task. The manual for the software says:

The size of insertions and deletions that can be found depend on how the reads are mapped: Only indels that are spanned by reads will be detected. This means that the reads have to align both before and after the indel. In order to detect larger insertions and deletions, please use the InDels and Structural Variation tool instead.

The CLC InDels and Structural Variation tool looks at the unaligned (soft-clipped) ends of short sequence reads, which is one way to get at structural variation with short read sequences. However, it might not have worked either; structural variation calling is a hard task, and the tool does not seem to be built for this kind of task.

What did Norris & al (2019) do differently? They took the published sequence data and aligned it to a cattle reference genome with the plasmid sequence added. Then, they loaded the alignment into the trusty Integrative Genomics Viewer and manually looked for reads aligning to the plasmid and reads supporting junctions between plasmid, template DNA and genome. This bespoken analysis is targeted to find plasmid insertions. The FDA authors must have gone ”nope, we don’t buy this” and decided to look for the plasmid.

Here is what they claim happened (Fig 1): The template DNA is there, as evidenced by the PCR genotyping, but it inserted twice, with the rest of the plasmid in-between.

F1.large-5.jpg

Here is the evidence (Supplementary figs 1 and 2): These are two annotated screenshots from IGV. The first shows alignments of reads from the calves and the unedited cell lines to the plasmid sequence. In the unedited cells, there are only stray reads, probably misplaced, but in the edited calves, ther are reads covering the plasmid throughout. Unless somehow else contaminated, this shows that the plasmid is somewhere in their genomes.

igv.png

Where is it then? This second supplementary figure shows alignments to expected junctions: where template DNA and genome are supposed to join. The colourful letters are mismatches, showing where unexpected DNA shows up. This is the evidence for where the plasmid integrated and what kind of complex rearrangement of template, plasmid and genome happened at the cut site. This must have been found by looking at alignments, hypothesising an insertion, and looking for the junctions supporting it.

igv2.png

Why didn’t the PCR and targeted sequencing find this? As this third supplementary figure shows, the PCRs used could, theoretically, produce longer products including plasmid sequence. But they are way too long for regular PCR.

pcr.png

Looking at this picture, I wonder if there were a few attempts to make a primer pair that went from insert into the downstream sequence, that failed and got blamed on bad primer design or PCR conditions.

In summary, the 2019 preprint finds indirect evidence of the plasmid insertion by looking hard at short read alignments. Targeted sequencing or long read sequencing could give better evidence by observing he whole insertion. Recombinetics have acknowledged the problem, which makes me think that they’ve gone back to the DNA samples and checked.

Where does that leave us with quality control of gene editing? There are three kinds of problems to worry about:

  • Off-target edits in similar places in other parts of the genome; this seems to be what people used to worry about the most, and what Carlson & al checked for
  • Complex rearrangements around cut site (probably due to repeated cutting; this became a big concern after Kosicki & al (2018), and should apply both to on- and off-target cuts
  • Insertion of plasmid or mutated target; this is what happened in here

The ways people check gene edits (targeted Sanger sequencing and short read sequencing) doesn’t detect any of them particularly well, at least not without bespoke analysis. Maybe the kind of analysis that Norris & al do could be automated to some extent, but currently, the state of the art seems to be to manually look closely at alignments. If I was reviewing the preprint, I would have liked it if the manuscript had given a fuller description of how they arrived at this picture, and exactly what the evidence for this particular complex rearrangement is. This is a bit hard to follow.

Finally, is this embarrassing? On the one hand, this is important stuff, plasmid integration is a known problem, so the original researchers probably should have looked harder for it. On the other hand, the cell lines were edited and the clones born before a lot of the discussion and research of off-target edits and on-target rearrangements that came out of CRISPR being widely applied, and when long read sequencing was a lot less common. Maybe it was easier to think that the sort read off-target analysis was enough then. In any case, we need a solid way to quality check edits.

Literature

Molteni M. (2019) Brazil’s plan for gene edited-cows got scrapped–here’s why. Wired.

Carlson DF, et al. (2016) Production of hornless dairy cattle from genome-edited cell lines. Nature Biotechnology.

Norris AL, et al. (2019) Template plasmid integration in germline genome-edited cattle. BioRxiv.

Tan W, et al. (2013) Efficient nonmeiotic allele introgression in livestock using custom endonucleases. Proceedings of the National Academy of Sciences.

Bastiaansen JWM, et al. (2018) The impact of genome editing on the introduction of monogenic traits in livestock. Genetics Selection Evolution.

Kosicki M, Tomberg K & Bradley A. (2018) Repair of double-strand breaks induced by CRISPR–Cas9 leads to large deletions and complex rearrangements. Nature Biotechnology.

‘Approaches to genetics for livestock research’ at IASH, University of Edinburgh

Publicerat i english, genetik, the practice of science av

A couple of weeks ago, I was at a symposium on the history of genetics in animal breeding at the Institute of Advanced Studies in the Humanities, organized by Cheryl Lancaster. There were talks by two geneticists and two historians, and ample time for discussion.

First geneticists:

Gregor Gorjanc presented the very essence of quantitative genetics: the pedigree-based model. He illustrated this with graphs (in the sense of edges and vertices) and by predicting his own breeding value for height from trait values, and from his personal genomics results.

Then, yours truly gave this talk: ‘Genomics in animal breeding from the perspectives of matrices and molecules’. Here are the slides (only slightly mangled by Slideshare). This is the talk I was preparing for when I collected the quotes I posted a couple of weeks ago.

I talked about how there are two perspectives on genomics: you can think of genomes either as large matrices of ancestry indicators (statistical perspective) or as long strings of bases (sequence perspective). Both are useful, and give animal breeders and breeding researchers different tools (genomic selection, reference genomes). I also talked about potential future breeding strategies that use causative variants, and how they’re not about stopping breeding and designing the perfect animal in a lab, but about supplementing genomic selection in different ways.

Then, historians:

Cheryl Lancaster told the story of how ABGRO, the Animal Breeding and Genetics Research Organisation in Edinburgh, lost its G. The organisation was split up in the 1950s, separating fundamental genetics research and animal breeding. She said that she had expected this split to be do to scientific, methodological or conceptual differences, but instead found when going through the archives, that it all was due to personal conflicts. She also got into how the ABGRO researchers justified their work, framing it as ”fundamental research”, and aspired to do long term research projects.

Jim Lowe talked about the pig genome sequencing and mapping efforts, how it was different from the human genome project in organisation, and how it used comparisons to the human genome a lot. Here he’s showing a photo of Alan Archibald using the gEVAL genome browser to quality-check the pig genome. He also argued that the infrastructural outcomes of a project like the human genome project, such as making it possible for pig genome scientists to use the human genome for comparisons, are more important and less predictable than usually assumed.

The discussion included comments by some of the people who were there (Chris Haley, Bill Hill), discussion about the breed concept, and what scientists can learn from history.

What is a breed? Is it a genetical thing, defined by grouping individuals based on their relatedness, a historical thing, based on what people think a certain kind of animal is supposed to look like, or a marketing tool, naming animals that come from a certain system? It is probably a bit of everything. (I talked with Jim Lowe during lunch; he had noticed how I referred to Griffith & Stotz for gene concepts, but omitted the ”post-genomic” gene concept they actually favour. This is because I didn’t find it useful for understanding how animal breeding researchers think. It is striking how comfortable biologists are with using fuzzy concepts that can’t be defined in a way that cover all corner cases, because biology doesn’t work that way. If the nominal gene concept is broken by trans-splicing, practicing genomicists will probably think of that more as a practical issue with designing gene databases than a something that invalidates talking about genes in principle.)

What would researchers like to learn from history? Probably how to succeed with large research endeavors and how to get funding for them. Can one learn that from history? Maybe not, but there might be lessons about thinking of research as ”basic”, ”fundamental”, ”applied” etc, and about what the long term effects of research might be.

How not to respond to CRISPR babies

Publicerat i english, genetik av

In December, after He Jiankui’s alleged experiment with human genome-editing, a Nature editorial said:

It has not yet been independently confirmed that the Chinese genome-editing researcher He Jiankui altered the DNA of embryos using a gene-editing technique and then implanted them in a woman, as he claims. Such a step would be significant and controversial because it would make a permanent change to the germ line that could be passed on to future generations. (This distinguishes germline editing from the use of gene-editing tools as therapies that correct genetic alterations in somatic cells in blood and other tissues.)

I think that this passage, like a lot of other discourse among scientists on this topic, fails to acknowledge, or at least emphasise, the real damage in this case.

When we insist on the germline–soma distinction as The Barrier for genome editing, and crossing The Barrier as the primary problem, we prioritise The Barrier over the actual people involved. The damage is not primarily to ‘the genome’, ‘the gene pool’, or ‘future generations’, but to the children born of the procedure, and their parents. The genome, on the other hand, is fine. It’s being fuzzed by random mutation every generation anyways.

Imagine this was instead a somatic gene ‘therapy’ experiment, with similarly vague potential benefits against similarly unknown and unchecked potential harms. Would it be fine? Of course not. It might be slightly less bad, because the women wouldn’t have to worry that their children would inherit the potential complications. That the variants are (may be) heritable is not unimportant, but it shouldn’t be the main concern.